Characterization of promoters in Escherichia coli and application for xylitol synthesis☆

Cuiwei Wang **,Zhe Li**,Aamir RasoolHongnan Qu Dazhang DaiChun Li*

1 School of Life Science,Beijing Institute of Technology,Beijing 100081,China

2 School of Chemistry and Chemical Engineering,Shihezi University,Shihezi 832003,China

Keywords:Escherichia coli Promoter Characterization Xylose reductase Xylitol

ABSTRACT Promoters are the most important tools to control and regulate the gene expression in synthetic biology and metabolic engineering.The expression of targetgenes in Escherichia coli is usually controlled by the high-strength inducible promoter with the result that the abnormally high transcription of these genes creates excessive metabolic load on the host,which decreases product formation.The constitutive expression systems are capable of avoiding these defects.In this study,to enrich the application of constitutive promoters in metabolic engineering,four promoters from the glycolytic pathway of E.coli were cloned and characterized using the enhanced green fluorescent protein as reporter.Among these promoters,PgapA was determined as the strongest one,the strength of which was about 8.92%of that of the widely used inducible promoter PT7.This promoter was used to control the expression of heterologous xylose reductase in E.coli for xylitolsynthesis so as to verify its function in pathway engineering.The maximum xylitoltiter(40.6 g·L?1)produced by engineered E.coli underthe control of the constitutive promoter PgapA was obviously higher than that under the control of the inducible promoter PT7,indicating the feasibility and superiority of promoter PgapA in the metabolic engineering of E.coli.

1.Introduction

Escherichia coli is the mostwidely used plat form organism not only for the production of a wide range of import an thigh-value compounds,such as taxol precursor[1],isoprene[2,3],terpenoids[4],5-Aminolevulinic acid[5],coenzyme Q10[6]and plant-specific phenylpropanoids[7],but also for the solution of global energy-related issues such as biofuel production and biomass conversion[8,9].In these studies,the construction of synthetic pathway frequently involves the expression of multiple genes.The gene expression is regulated by a series of distinct,yet interwoven,levels of regulatory control occurring at the transcriptional,translational and protein levels[10].One of the fundamental methods to alter the gene expression level is to control transcription at the promoter level.Hence,metabolic engineering application relies on effective promoter discovery and characterization.

The selection of promoters has attracted the attention of the researchers in most pathway engineering studies because selection of appropriate promoters plays a significant role in yield and productivity optimization.This is not only because gene expression level is controlled by the promoter strength,but also because promoters could be regulated and behave differently under different growth conditions[11].For example,Alper et al.constructed a promoter library to achieve precise strength and regulation,and tested the utility of the promoter library by investigating the lycopene production[12].Duan et al.obtained 27%enhancement of riboflavin production by using the vegetative growth promoter P43[13].Liu et al.utilized the turbulence promoter to improve the permeate flux of membrane in the cross flow micro filtration of calcium carbonate suspension[14].Others also maximized the production of approximately 1 g·L?1taxadiene with minimal accumulation of toxic intermediate by systematically optimizing the promoters with different strengths and plasmid copy numbers[1].Therefore,it is imperative to characterize these promoters and evaluate their behavior under different growth conditions.

Among these selected promoters,two very high-strength phagederived promoter systems based on the T7 RNA polymerase and the PLtemperature-regulated phage promoter systems are frequently used to regulate the gene expression[15-18].However,the high transcriptional level creates redundant metabolic load for the E.coli host.The strong overexpression is not always optimal for a given gene,so a range of promoter strength is necessary.The constitutive expression systems as alternative are able to avoid the problem[19],because they offer several advantages over inducible systems that require a chemical or physical inducer.

In order to offer more information to appropriate promoter selection for gene expression control,the precise characterization of four constitutive promoters from E.coli is completed using enhanced green fluorescent protein(eGFP)as reporter gene at the translational and transcriptional levels.In order to verify the utilization of these promoters,the strongest promoter PgapAis chosen to compare with the widely used inducible promoter PT7in xylitol production.

2.Materials and Methods

2.1.Strains,media and reagents

E.coli BL21(DE3)pLys was used for promoter characterization and xylitol production.Candida tropicalis BIT-Xol-1 used to clone the xylose reductase(XR)gene xr was preserved in our laboratory.Luria-Bertani(LB)with 50 μg·ml?1kanamycin was used as cultivation medium for E.coli transformants.Restriction enzymes,T4 ligase and high- fidelity DNA polymerase were purchased from Fermentas(Burlington,ON).The plasmid pET-28a(+)was obtained from Novagen(Darmstadt,Germany).The primers were purchased from Sangon Biotech(Shanghai,China).

2.2.Plasmid construction

All plasmids for promoter characterization and xylose reductase expression were derivates of plasmid pET-28a(+).Promoters Ppgi,PgapA,PpykAand PpykFfrom the glycolytic pathway were amplified from E.coli C600 genomic DNA and their sequences were retrieved from the NCBI database.The expression cassettes of promoters and egfp were constructed by overlap extension PCR.BamH I and Bgl II were employed to digest plasmid pET-28a(+)and promoter PT7was released from the plasmid.The expression cassettes composed of promoters and egfp were also digested with the same restriction enzymes and ligated with linearized pET-28a(+).

Gene xr was PCR-amplified from the genomic DNA of C.tropicalis.The XR expression cassette containing promoter PgapAand gene xr was constructed by overlap extension PCR.The XR expression plasmid(pET-28a(+)-gapA-xr)under promoter PgapAwas constructed by ligating the XR expression cassette with pET-28a(+)digested by BamH I and Bgl II.The XR expression plasmid(pET-28a(+)-T7-xr)under promoter PT7was prepared after ligating linearized pET-28a(+)with gene xr digested by BamH I and Xho I.Strains and plasmids used in this study are listed in Table 1.

2.3.Cultivation and fermentation conditions

For the recombinant strains harboring the four constitutive promoters,300 μl overnight cultures were inoculated into a fresh 30 ml LB-kan medium and grown at 37 °C,170 r·min?1.The recombinant strain BL21-T7-egfp was induced by 0.2 mmol·L?1IPTG at 25 °C when OD550reached 0.8.Then,the cells were harvested to determine the mRNA level and eGFP expression by quantitative PCR and flow cytometry,respectively.

For strain BL21-gapA-xr,the overnight cultures were inoculated to an initial OD550of 0.1 and grown at 37 °C,170 r·min?1.For strain BL21-T7-xr,the cultures were induced by 0.2 mmol·L?1IPTG at 25 °C when OD550reached 0.8.The cells were harvested for SDS-PAGE and enzyme activity determination.

The fermentation of strain BL21-gapA-xr for initial xylose concentration optimization was performed in a 250 ml shake flask with 100 ml LB-kan media containing xylose of different concentrations at 37°C,170 r·min?1.To determine its optimal feeding concentration,xylose was added at 48,72,96,120,144 and 168 h.For the strain BL21-T7-xr,the optimal IPTG concentration,induction temperature and initial xylose concentration were investigated in a 250 ml shake flask with 100 ml LB medium at 170 r·min?1.Each fermentation was carried out in triplicate.

2.4.Measurement of eGFP fluorescence intensity

The eGFP fluorescence intensity of the cells was measured using flow cytometry.Brie fly,cells were harvested by centrifugation at 10000 g for 2 min,washed and subsequently resuspended in phosphate buffer solution to an OD550of 0.5-0.6.Flow cytometry analysis was performed at Beckman-Coulter CyAn ADP(Dako,Carpinteria,CA).The fluorescence intensity of eGFP was calculated by subtracting the arithmetic mean of auto- fluorescence distribution of control from the fluorescence of sample.

2.5.RNA extraction and quantitative PCR

E.coli cells harvested at the exponential growth phase were used for the total RNA extraction using a High Pure RNA Isolation Kit(Roche,Mannheim,Germany).RNA concentration was quantified by measuring the absorbance at 260 nm using NanoDrop 2000c(Thermo Scientific,Waltham,MA).All RNA samples were stored at?80 °C.

Five hundred nanograms of RNA from each sample was used as a template for the Transcriptor First Strand cDNA Synthesis Kit(Roche).Quantitative PCR analysis was performed with the LightCycler SYBR Green I Master Kit on the LightCycler 480 real-time System using 96well fast plates(Roche).The data were analyzed using Light Cycler Software(v.1.5).The housekeeping gene act1 was used as a reference gene.All assays were performed in triplicate,and the reaction without reverse transcriptase was used as a negative control.

2.6.Determination of protein concentration

Protein concentration was determined by the method of Bradford with bovine serum albumin(BSA)as a standard protein for the estimation.A stock of BSA was prepared with 1 mg·ml?1concentration.Take 10-100μg·ml?1dilutions and makeup the volume of1 ml with distilled water.5 ml of Bradford reagent was added in each tube.After 10 min,OD was measured at 595 nm.The absorbance against protein concentration was plotted to get a standard curve.The absorbance of the unknown sample was checked and the concentration of the unknown sample was determined by using the standard curve.

2.7.XR activity assay

XR activity was determined spectrophotometrically by monitoring the change in A340upon NADPH oxidation at 25 °C and 37 °C.Cultured cells were harvested by centrifugation(12000 g,1 min),washed with 50 mmol·L?1potassium phosphate buffer(pH 7.0),suspended in the same buffer,and disrupted using ultrasonic treatment.Cell debris was separated by centrifugation(12000 g,1 min)and the supernatant was used for measurement of enzyme activity.The XR assay mixture contained 0.1 mol·L?1potassium phosphate buffer(pH 7.0),0.15 mmol·L?1NADPH,0.2 mol·L?1D-xylose,and enzyme solution.The assay mixture was allowed to stand for 1 min to remove the endogenous oxidation of NADPH.The oxidation reaction was started with the addition of enzyme solution.XR activity was expressed as specific activity per mg of protein,and one unit activity corresponds to 1 μmol·L?1NADPH conversion per min.Each measurement was carried out in triplicate.

2.8.Analytical methods

Xylitol concentration was determined using a Shimadzu SLC-10A HPLC equipped with a refractive index detector.Product xylitol was separated using a Bio-Rad HPX-87H column(10 μl injection)with 5 mmol·L?1H2SO4as the mobile phase(0.6 ml·min?1,60 °C).

Cell concentration of the sample was determined by measuring the optical density(OD550)using a spectrophotometer,model U-2900(HITACHI,Chiyoda,Tokyo).The control was the fermentation medium without cells.

3.Results

3.1.Characterization of constitutive promoters in E.coli

The constitutive promoters mostly come from housekeeping genes and glycolysis is one of the best understood pathways,so promoters PgapA,PpykF,Ppgiand PpykAfrom the glycolytic pathway were cloned and characterized.The strengths of promoters were evaluated by measuring eGFP fluorescence intensity.The results show that promoter PgapAexhibits the highest strength among the four constitutive promoters,whereas promoters PpykF,Ppgiand PpykAshow about 20.8%,13.0%and 12.0%of the strength of PgapA,respectively[Fig.1(a)].In order to compare the strengths of promoters in this work with other promoters widely used,promoter PT7is selected as reference control.The strength ofPgapArepresents about8.92%of that of promoter PT7.Additionally,the strengths of the 4 promoters determined by measuring the relative mRNA level of egfp through quantitative PCR indicate that the transcription exactly matches the fluorescence intensity[Fig.1(b)].In other words,promoters with higher eGFP intensity generally exhibit higher relative mRNA levels.

Fig.1.Comparison of strengths of five promoters.(a)The mean fluorescence intensity of eGFP;(b)relative mRNA level;error bars:the standard deviations of three independent experiments.

The SDS-PAGE results of eGFP(26.9 kDa)under the control of different promoters are shown in Fig.2.In the engineered BL21-T7-egfp,the target protein band was observed in supernatant and precipitate,and the amount of eGFP in the supernatant was more than that in the precipitate.The result indicates that the target protein exists mainly in the form of soluble protein in the stain BL21-T7-egfp.However,the target protein in the four engineered strains expressed by constitutive promoters was present in the supernatant rather than in the precipitate,indicating that eGFP exists solely in the form of soluble protein.In addition,the amount of soluble eGFP controlled by promoter PT7was much more than that controlled by the four constitutive promoters,which verifies that the strength of promoter PT7is the highest in the five promoters.Such results are also correlated with relative mRNA levels and mean fluorescence levels.By analyzing the soluble protein proportion of eGFP,it is obtained that the eGFP in the four constitutive expression strains is 100%soluble,while the soluble eGFP proportion of PT7is 62.5%,although the total amount of the soluble protein expressed by PT7is the highest.

3.2.Different construction approaches for xylitol biosynthesis with constitutive and inducible promoters

Fig.2.SDS-PAGE analysis of location and existing state of eGFP,with proteins stained with Coomassie Blue.(a)Lane M protein maker,lane 1 whole cell of BL21(DE3)pLys,lane 2 non-induced whole cell of BL21-T7-egfp,lane 3 centrifugal supernatant from ultrasonic disruption of cells BL21-T7-egfp,and lane 4 cell precipitate from ultrasonic disruption of cells BL21-T7-egfp;(b)lane M protein maker,lane 1 whole cell of BL21(DE3)pLys,lane 2 centrifugal supernatant from ultrasonic disruption of cells BL21-gapA-egfp,and lane 3 cell precipitate from ultrasonic disruption of cells BL21-gapA-egfp;(c)lane M protein maker,lane 1 whole cell of BL21(DE3)pLys,lane 2 centrifugal supernatant from ultrasonic disruption of cells BL21-pgi-egfp,and lane 3 cell precipitate from ultrasonic disruption of cells BL21-pgi-egfp;(d)lane M protein maker,lane 1 whole cell of BL21(DE3)pLys,lane 2 centrifugal supernatant from ultrasonic disruption of cells BL21-pykA-egfp,and lane 3 cell precipitate from ultrasonic disruption of cells BL21-pykA-egfp;and(e)lane M protein maker,lane 1 whole cell of BL21(DE3)pLys,lane 2 centrifugal supernatant from ultrasonic disruption of cells BL21-pykF-egfp,and lane 3 cell precipitate from ultrasonic disruption of cells BL21-pykF-egfp.

As an application example of these constitutive promoters in metabolic engineering,promoter PgapAwith the highest strength and the inducible promoter PT7were used to express XR to produce xylitol,resulting in the strains BL21-gapA-xr and BL21-T7-xr.The SDS-PAGE analysis shows that XR(40 kDa)is expressed successfully in both engineered strains.Moreover,the thick target protein band under promoter PT7detected in the precipitate after ultrasonic disruption indicates that the target protein exists mainly in the form of inclusion body(Fig.3).The XR controlled by promoter PgapAobserved only in the supernatant reveals that XR exists in the form of soluble protein in the strain BL21-gapA-xr.From Fig.3,we also obtain that the soluble XR protein in the strain BL21-gapA-xr is more than that in strain BL21-T7-xr.The soluble protein proportion of XR controlled by promoters PgapAand PT7was 100%and 13.4%,respectively.The XR activity was determined as 11.0 U·mg?1for strain BL21-gapA-xr and 4.15 U·mg?1for strain BL21-T7-xr at different temperatures(37 °C and 25 °C,respectively),where the xylitol titers of these two strains were the highest(Table 2).

Fig.3.SDS-PAGE analysis of location and existing state of XR with proteins stained with Coomassie Blue.(a)Lane M protein maker,lane 1 whole cell of BL21(DE3)pLys,lane 2 non-induced whole cell of BL21-T7-xr,lane 3 centrifugal supernatant from ultrasonic disruption of cells BL21-T7-xr,and lane 4 cell precipitate from ultrasonic disruption of cells BL21-T7-xr;(b)lane M protein maker,lane 1 whole cellof BL21(DE3)pLys,lane 2 centrifugal supernatant from ultrasonic disruption of cells BL21-gapA-xr,and lane 3 cell precipitate from ultrasonic disruption of cells BL21-gapA-xr.

Table 2 Comparison of enzyme activities of xylose reductase

3.3.Optimization of fermentation parameters for xylitol production

To find the optimal fermentation condition for xylitol production in shake- flasks,the key factors affecting the xylitol production were determined.The maximum xylitol titer of 8.48 g·L?1and the complete consumption of xylose were obtained in the fermentation of engineered strain BL21-gapA-xr at the initial xylose concentration of 15 g·L?1(Fig.4).With low xylose concentration the engineered strain metabolized the xylose for cell growth instead of xylitol synthesis;on the other hand,the engineered strain could not consume all xylose at concentrations higher than 15 g·L?1xylose.For fermentation by engineered strain BL21-T7-xr,three parameters(IPTG concentration,induction temperature and initial xylose concentration)were optimized.As shown in Fig.5,the optimum IPTG concentration was 0.2 mmol·L?1with similar xylose consumption under different conditions.Xylose consumption increased gradually with the induction temperature,because the engineered strain needed more xylose to grow at an appropriate growth temperature.However,the optimal induction temperature was 25°C for xylitol production(Fig.6).The xylitol production reached the maximum with an initial xylose concentration of 10 g·L?1.The engineered strain completely metabolized xylose when its initial concentration was 5 g·L?1and a little xylose would be remained while its concentration was higher than 5 g·L?1(Fig.7).The comparison of xylitol production between the two engineered strains is presented in Table 3.The xylitol titer,max yield and maximal productivity of BL21-gapA-xr are higher than those of BL21-T7-xr.

Fig.4.Initialxylose concentration optimization for xylitol production by engineered strain BL21-gapA-xr.Initial xylose concentration 5 g·L?1:■ xylitol production,□ xylose remained;initialxylose concentration 10 g·L?1:●xylitol production,○ xylose remained;initial xylose concentration 15 g·L?1:▲ xylitol production,△ xylose remained;initial xylose concentration 20 g·L?1:▼ xylitol production,▽ xylose remained;error bars:standard deviations of three independent experiments.

Fig.5.IPTG concentration optimization for xylitol production by engineered strain BL21-T7-xr.Strain:cultured in LB-kan medium containing 10 g·L?1 xylose at 20 °C;data:obtained at 96 h with xylitol production at the maximum;error bars:standard deviations of three independent experiments.

Fig.6.Induction temperature optimization for xylitol production by engineered strain BL21-T7-xr.Strain:cultured in LB-kan medium containing 10 g·L?1 xylose and induced by 0.2 mmol·L?1 IPTG;data:obtained at 96 h with xylitol production at the maximum;error bars:standard deviations of three independent experiments.

Fig.7.Initial xylose concentration optimization for xylitol production by engineered strains BL21-T7-xr.Initial xylose concentration 5 g·L?1:■ xylitol production,□ xylose remained;initial xylose concentration 10 g·L?1:●xylitol production,○xylose remained;initial xylose concentration 15 g·L?1:▲ xylitol production,△ xylose remained;initial xylose concentration 20 g·L?1:▼ xylitol production,▽ xylose remained;error bars:standard deviations of three independent experiments.

Table 3 Comparison of xylitol production between strain BL21-gapA-xr and BL21-T7-xr

3.4.Fed-batch fermentation for strain BL21-gapA-xr producing xylitol

Fig.8.The optimization of xylose feeding concentration for xylitol production by engineered strain BL21-gapA-xr.Strain:cultured in LB-kan containing 15 g·L?1 initial xylose at 37 °C;with extra 3 g·L?1 xylose added:■ xylitol production,□ xylose remained;with extra 5 g·L?1 xylose added:● xylitol production,○ xylose remained;with extra 8 g·L?1 xylose added:▲ xylitol production,△ xylose remained;error bars:standard deviations of three independent experiments.

The effect of xylose feeding concentration on the xylitol production by BL21-gapA-xr was also determined by supplementing additional xylose in the growth medium every 24 h aftera 48 h fermentation.The xylose feeding concentration was individually tested at three different levels,3,5 and 8 g·L?1.A positive response for xylitol production can be seen at all the levels tested(Fig.8).Further results are shown in Table 4.The xylitol titer,yield and productivity reach the maximum(40.6 g·L?1,73.8%,and 0.242 g·L?1·h?1,respectively)at the xylose feeding concentration of 8 g·L?1.

4.Discussion

Simple promoter-gene cassettes have been an essential component of the metabolic engineering paradigm since its first description[20],and promoters have become focal points as enabling“parts”for synthetic biology applications[21].Promoter selection is crucial to maximize protein production in metabolic engineering.E.coli is frequently selected as a host for over expression of heterologous proteins.Currently,only a few promoters are used for protein production,though hundreds of E.coli promoter sequences have been elucidated[22].Among these selected promoters,the most widely used ones are the inducible promoters with very high strength.However,the excessive transcriptional capacity of these systems leads to a decrease of product formation[23].Hence,it is significant to use the constitutive promoters with relatively lower strength to control the gene expression.

Table 4 Comparison of xylitol production by strain BL21-gapA-xr at different xylose feeding concentrations

Some studies about these four constitutive promoters in E.coli are available[24-27],but the systematic strength analysis using eGFP as a reporter gene is little.In this study,the constitutive E.coli promoters PgapA,PpykF,Ppgiand PpykAfrom the glycolytic pathway are cloned and characterized.Using the eGFP reporter system,the strength of these promoters will provide guidance for future metabolic engineering.The characterization of the promoters indicates that varying levels of eGFP synthesis under the four promoters have similar trends in both the translational and transcriptional levels(Fig.1).Furthermore,no inclusion body has been observed with the protein expressed under the constitutive promoters(Fig.2).This result is further verified by the proportion comparison of soluble eGFP protein.Thus expressing heterologous protein under the control of a constitutive promoter may be an important alternative because the redundant inactive protein as burden for the host is not produced.In order to compare the effect on expressing heterologous genes between the highest strength constitutive promoter PgapAand the widely used inducible promoter PT7,the two promoters are applied to express XR for xylitol production.Interestingly,although more eGFP is in the form of soluble protein under the control of promoter PT7,the situation is reversed with XR expression,with inactive XR protein as the major product under the control of the same promoter.It is concluded that expression of different heterologous genes behaves differently even controlled by the same promoter.

Under the optimized fermentation condition,the xylitol production controlled by the constitutive promoter PgapAis 2.9 times that controlled by the inducible promoter PT7in batch fermentation(Table 3),though the strength of PT7is much higher than that of PgapA(Fig.1),because no inclusion body and more soluble XR were produced in the engineered strain BL21-gapA-xr(Fig.3);furthermore,the XR activity under promoter PT7is inferior to that under promoter PgapA(Table 2).

In recent years,the strong inducible promoter Ptachas been utilized to express XR for producing xylitol in E.coli,with the maximum titer being 0.608[28],7.00[29],19.8[30],38.0[31],and 44.3 g·L?1[32].The maximum titer of xylitol is 40.6 g·L?1under the control of promoter PgapAin this study.It indicates that the constitutive promoter PgapAis feasible to control the XR expression for xylitol production and highly useful in metabolic engineering in E.coli.Although inducible promoters allow a continuous control of expression at the macroscopic level,practical applications of these systems are limited by prohibitive inducer costs,hypersensitivity to inducer concentration,and transcriptional heterogeneity at the single-cell level[33,34].The application of constitutive promoters exhibits the merit thatno inducer is needed in the fermentation process.Consequently,the production cost is deceased and the production process is simplified with the utilization of the constitutive promoters.

Appendix

A.1.Sequences of oligonucleotide primers for construction of plasmids pET-28a(+)-promoter-egfp

(1)Ppgi-5′:GGAAGATCT AACTACCTCGTGTCAGGGGA Ppgi-3′:CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATTAG CAATACTCTTCTGATTT

(2)PgapA-5′:GGA AGATCT TTGCTCACATCTCACTTTAA PgapA-3′:CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATA TATTCCACCAGCTATTTGT

(3)PpykA-5′:GGA AGATCT AAACGACTGTCACTGTCCTA PpykA-3′:CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATG TAATACTCCGTTGACTGAA

(4)PpykF-5′:GGAAGATCT TCTTTATACCTATTTATCAT PpykF-3′:CACCACCCCGGTGAACAGCTCCTCGCCCTTGCTCACCATG ACAGTCTTAGTCTTTAAGT

(5)Pegfp-5′:ATGGTGAGCAAGGGCGAGGA Pegfp-3′:CGC GGATCC TTACTTGTACAGCTCGTCCA

(6)Pegfp′-5′:CGC GGATCC ATGGTGAGCAAGGGCGAGGA Pegfp′-3′:CCCA AGCTT TTACTTGTACAGCTCGTCCA

A.2.Sequences of oligonucleotide primers for construction of plasmids pET-28a(+)-promoter-xr

(1)PgapA-5′:CGC GGATCC T TGCTCACATCTCACTTTAA PgapA-3′:TCTCTTTATAGTTGTTGGAGAAGTGAAAAATTTAAACATA TATTCCACCAGCTATTTGT

(2)Pxr-5′:CGC GGATCC T TGCTCACATCTCACTTTAA Pxr-3′:TCTCTTTATAGTTGTTGGAGAAGTGAAAAATTTAAACATATA TTCCACCAGCTATTTGT

(3)Pxr′-5′:CGC GGATCC ATGTTTAAATTTTTCACTTC Pxr′-3′:CCGCTCGAG TTAAACAAAGATTGGAATGT