Combination of neutrophil gelatinase-associated lipocalin and matrix metalloproteinase-9 are biomarkers for the detection of colon tubular adenocarcinoma

Jun-Hua Yuan,Li-Shuang Xie,Yu-Hua Zhu,Xiao-Hua Wang,Yi-Jing Zhang,Xiao-Jun Wang

Jun-Hua Yuan,Yi-Jing Zhang,Xiao-Jun Wang,Department of Geriatric Gastroenterology,Shandong Provincial Hospital Affiliated to Shandong First Medical University,Jinan 250021,Shandong Province,China

Li-Shuang Xie,Medical Records Room,Yinan County People’s Hospital,Yinan 276399,Shandong Province,China

Yu-Hua Zhu,Department of Infectious Diseases,Shandong Provincial Hospital Affiliated to Shandong First Medical University,Jinan 250021,Shandong Province,China

Xiao-Hua Wang,Department of Infectious Diseases and Liver Diseases,Jinan Infectious Disease Hospital,Shandong University School of Medicine,Jinan 250021,Shandong Province,China

Abstract BACKGROUNDTubular adenocarcinoma of the colon,which originates from the epithelium of the glands,is a major health concern worldwide.However,it is difficult to detect at an early stage.The lack of biomarkers is a main barrier to the diagnosis and treatment of tubular adenocarcinoma.Neutrophil gelatinase-associated lipocalin(NGAL)is a secreted protein that induces the expression of matrix metalloproteinase-9(MMP-9)and is involved in various tumors.NGAL and MMP-9 have been reported to be associated with tumorigenesis and development.They may have potential as biomarkers for diagnosis of tubular adenocarcinoma of the colon.AIMTo determine whether NGAL and MMP-9 can be used as potential biomarkers to indicate the progression of tubular adenocarcinoma of the colon.METHODSSamples were collected from surgically excised tissue from various patients.The content of pro-gastrin-releasing peptide(pro-GRP)in the serum was measured by an electrochemiluminescence immunoassay.The expression patterns of NGAL and MMP-9 and the relationship between NGAL and MMP-9 were examined by quantitative real-time PCR,Western blotting and immunohistochemical analysis.RESULTSIn this study,we found that NGAL and MMP-9 can be used as biomarkers for the detection of tubular adenocarcinoma of the colon and that their combination improved diagnostic accuracy.By analyzing the expression of NGAL in tubular adenocarcinoma at different levels,we found that NGAL expression was significantly upregulated in primary tubular adenocarcinoma tissues compared with normal tissues.The upregulation of NGAL expression was strongly correlated with both the degree of differentiation and the disease stage(I–III),indicating that NGAL could serve as a diagnostic biomarker for tubular adenocarcinoma.When using NGAL as a biomarker for diagnosis,the accuracy was similar to that achieved with the widely used biomarker pro-GRP,suggesting that NGAL is reliable.Moreover,the expression of MMP-9 was also strongly correlated with the differentiation stage,demonstrating that MMP-9 could be used as a biomarker to indicate the progression of tubular adenocarcinoma of the colon.More importantly,the combination of NGAL and MMP-9 produced a more accurate diagnosis of tubular adenocarcinoma,and these results were further confirmed by immunohistochemical analysis of tissue sections.CONCLUSIONOur study demonstrated that both NGAL and MMP-9 can be used as biomarkers for the diagnosis of colon tubular adenocarcinoma and that the results could be further improved by combining them.

Key Words:Tubular adenocarcinoma;Colon;Neutrophil gelatinase-associated lipocalin;Matrix metalloproteinase-9;Biomarker

INTRODUCTION

Colorectal cancer(CRC)is the third most common cancer worldwide with 1.36 million people diagnosed in 2012,which contributed to 9.7% of cancer cases[1].In China,CRC is the fourth most common malignant cancer,and has increased rapidly,especially in developing regions[2,3].CRC is caused by numerous factors,which are associated with heritability,lifestyle,chronic inflammation and so on[4-6].Although early stage III CRC can be curedviasurgical excision,advanced stage III-IV CRC is usually lethal and incurable[7,8].Most CRC cases are tubular adenocarcinomas,which comprise approximately 95%,and are characterized by peritoneal dissemination and infiltrative growth[9].Early diagnosis of colorectal adenocarcinoma is obviously important in the treatment of primary or recurrent colorectal adenocarcinoma.

Advances in the understanding of colorectal carcinogenesis offer opportunities to identify biomarkers for earlier diagnosis.Recent studies demonstrated that neutrophil gelatinase-associated lipocalin(NGAL)and matrix metalloproteinase-9(MMP-9)could be used as diagnostic and prognostic biomarkers in various cancers,including breast cancer[10],bladder cancer[11,12],gastric cancer[13],endometrial cancer[14]and kidney tumors[15].NGAL,also called lipocalin-2(LCN2),is a small glycoprotein,which is encoded by theLCN2gene.As a member of the lipocalin family,NGAL participates in the transportation of lipophilic substances.Additionally,it has also been reported that NGAL is associated with the delivery of iron from the extracellular space into the inner cell,which may promote tumor development and support the proliferation of neoplastic cells[16,17].Previous studies revealed that increased expression of NGAL contributed to the progression of cancers[18,19],and in a number of malignancies,NGAL was over-expressed[20,21].MMP-9 is one of the matrixmetalloproteinases,whose activity is modulated by NGAL[22].MMP-9 can degrade the extracellular matrix(ECM),which is the barrier to cell invasion.Degradation of the ECM can provide a favorable environment for promoting the growth and dissemination of cancer cells.The increased expression level of MMP-9 has been observed in several cancers,which was related to the aggressiveness of cancer cells and the overall survival of patients[23].In combination with NGAL,MMP-9 can avoid proteolytic degradation,which increases its enzymatic activity and the movability of malignancies[10].

NGAL,MMP-9,and their complex have shown value as diagnostic and prognostic biomarkers in several cancers.However,their value in tubular adenocarcinoma of the colon remains unknown.Therefore,in the present study,we evaluated the potential of NGAL and MMP-9 as biomarkers for the early detection of tubular adenocarcinoma of the colon and explored the possible application of combining these two biomarkers.

MATERIALS AND METHODS

Patients and samples

This study included 15 female and 32 male patients aged 45 to 80 years treated in the Provincial Hospital Affiliated to Shandong University.In total,30 samples of tubular adenocarcinoma of the colon were collected from the patients who underwent surgical excision between 2015 and 2019.Ten patients had polyps(I),10 patients had mild tubular adenocarcinoma(II)and 10 patients had severe tubular adenocarcinoma(III),respectively,confirmed by a pathologist.In addition,10 normal samples were included as controls.All experiments were in compliance with the ethical standards of the World Medical Association Declaration of Helsinki,the samples were only used for research and consent was obtained from the patients before the start of the experiment.

Detection of pro-gastrin-releasing peptide

Serum samples were tested using a commercial electrochemiluminescence immunoassay for pro-gastrin-releasing peptide(pro-GRP)with the Roche C6000 automated immunoassay analyzer(Roche Diagnostics GmbH,Penzberg,Germany)[24].

Quantitative real-time PCR analysis

Total RNA was extracted from serum samples with TRIzol Reagent(DP405-02,TIANGEN Biotech,Beijing,China),after which cDNA was synthesized with reverse transcriptase(RR047B,Takara,Beijing,China)in accordance with the manufacturer’s instructions.Quantitative real-time PCR(qRT-PCR)was performed using SYBR?Premix Ex Taq? II(Tli RNaseH Plus,TaKaRa,Japan)to detect the mRNA levels of NGAL and MMP9.Reaction parameters were as follows:95oC for 30 s,followed by 45 cycles at 95oC for 5 s and 60oC for 40 s.Data were collected and analyzed with GraphPad and SPSS 25.0.The expression of genes within a sample was normalized to GAPDH expression by employing the 2ΔΔCtmethod.The primers used in the present study were as follows:NGAL(Forward:ACAAAGACCCGCAAAAGATG;Reverse:TTGGGACAGGGAAGACGAT),and MMP9(Forward:GAGCACGGAGACGGGTATC;Reverse:ACTCGTCATCGTCGAAATGG).

Western blotting

Western blotting for NGAL and MMP-9 was carried out.Serum sample lysates were thawed and mixed with an equal volume of 2X buffer.10% sodium dodecyl sulfate polyacrylamide gel electrophoresis(SDS-PAGE)was used to separate proteins and the proteins were then transferred onto a polyvinylidene difluoride(PVDF)membrane.Anti-NGAL antibody(ab41105)and anti-MMP-9 antibody(ab38898)obtained from Abcam(Cambridge,United Kingdom)and B-actin monoclonal antibody(YM3028)obtained from Immunoway(Plano,United States)were employed as primary antibodies.The membrane was incubated with primary antibodies at 4oC overnight and secondary antibodies at 37oC for 40 min,respectively.Enhanced chemiluminescence(ECL,WBKLS0500,Millipore,MA,United States)solution was used to visualize the bands.The blots were subsequently scanned,and band intensity was quantified based on densitometry software(ImageJ,National Institutes of Health,Bethesda,MD,United States).

Immunohistochemical analysis

For immunohistochemical(IHC)analysis of tumor tissues,the samples were rinsed with PBS,fixed with 4% paraformaldehyde for 1 h and embedded in paraffin.Sections of 5 μm thickness were prepared for IHC staining.Briefly,the slides were rehydrated using a gradient.Sodium citrate buffer solution(pH 6.0)was used for antigen retrieval.To avoid the influence of endogenous peroxidase activity,0.3% hydrogen peroxide was added for 10 min.In addition,3% calf serum was applied to block the sections.The sections were subsequently stained with the same primary antibodies as above.Then the samples were incubated with the universal secondary antibody and VECTASTAIN Elite ABC reagent(PK6200,Vector,Germany),reacted with 3,3′-Diaminobenzidine tetra hydrochloride hydrate(DAB,Thermo Fisher Scientific,Waltham,United States),and counterstained with hematoxylin(H3404,Vector,Germany).The images were captured using an optical microscope.

Statistical analysis

Unless otherwise indicated,all experiments were carried out in triplicate.Error bars represent standard deviations.Data are presented as mean value ± SE from three independent measurements,and values ofP<0.05 were considered statistically significant.Graphs were plotted and analyzed using GraphPad and SPSS 25.0.

RESULTS

The expression of NGAL was positively correlated with the occurrence of tubular adenocarcinoma of the colon

It has been reported that NGAL can be used as a biomarker to detect some cancers.However,the potential value of NGAL in tubular adenocarcinoma of the colon remains unknown.Therefore,we first analyzed 6 samples from patients(Table 1),who were diagnosed with tubular adenocarcinoma of the colon.The mRNA expression level of NGAL was evaluated by qRT-PCR.Figure 1A shows that the expression of NGAL was significantly higher in tubular adenocarcinoma of the colon in comparison with the control sample.The biomarker pro-GRP,is commonly used in the diagnosis of tubular adenocarcinoma[24,25].As shown in Figure 1B and Table 1,pro-GRP was detected in the serum of these 6 patients.According to the results obtained,we found that the expression of NGAL was consistent with the expression of pro-GRP in various patients,suggesting that the expression of NGAL in serum was positively correlated with the occurrence of tubular adenocarcinomas of the colon.

Table 1 Serum levels of pro-gastrin-releasing peptide and neutrophil gelatinase-associated lipocalin in tubular adenocarcinoma patients

Figure 1 The relative expression of neutrophil gelatinase-associated lipocalin was consistent with the content of pro-gastrin-releasing peptide in serum.A:The relative gene expression of neutrophil gelatinase-associated lipocalin in serum in normal and six samples of tubular adenocarcinoma of the colon(P1 to P6);B:The content of pro-gastrin-releasing peptide(pg/mL)in serum.Three independent experiments were carried out and analyzed.Data are expressed as mean values ± SE,bP<0.01,two-tailed Student’s t-tests.NGAL:Neutrophil gelatinase-associated lipocalin;pro-GRP:Pro-gastrin-releasing peptide.

NGAL and MMP-9 can indicate the progression of tubular adenocarcinoma

In order to confirm the relationship between NGAL and the occurrence of tubular adenocarcinoma,more samples were analyzed.We collected more samples of tubular adenocarcinoma of the colon,including polyps(I),mild tubular adenocarcinoma(II)and severe tubular adenocarcinoma(III),as shown in Table 2.The qRT-PCR results in Figure 2A reveal that increased gene expression of NGAL was found in all cases,while the increment varied.In addition,we also found that with the development of tubular adenocarcinoma,the mean expression levels of NGAL were increased,and the expression of NGAL was higher in stage II and III than that in stage I.We then assessed the expression of MMP-9,which can be induced by NGAL.As expected,both NGAL and MMP-9 gradually increased with progression of the disease,although the gene expression of MMP-9 was extremely low in stage I,it was still slightly higher than that in the control group(Figure 2B).

We further determined the protein level of NGAL and MMP-9 using Western blotting.Typical samples(N-4,I-5,II-3,III-6)were selected for tested.According to the results,we found that the hybridization signal of NGAL was gradually enhanced from the control group to stage III,indicating the progression of tubular adenocarcinoma(Figure 2C),which was consistent with the results of qRT-PCR.The expression level of MMP-9 in stage I was slightly higher than that in the control group,and it continued to increase in stage II and III(Figure 2D),suggesting that MMP-9 was induced by NGAL,and the expression of MMP-9 might occur later than NGAL.More importantly,it was also found that MMP-9 increased as tubular adenocarcinoma of the colon progressed.

IHC staining was also used to detect thein situexpression of NGAL and MMP-9.The tissue samples used for IHC staining were from the same patients(N-4,I-5,II-3,III-6).Hybridization with anti-NGAL and anti-MMP-9 antibodies revealed that NGAL and MMP-9 in the lesion were both higher than those in the control.With progression of the disease,the signals became stronger(Figure 3).Therefore,it can be concluded that both NGAL and MMP-9 can be used as biomarkers to indicate the progression of tubular adenocarcinoma of the colon.

The combination of NGAL and MMP-9 can improve the accuracy of the diagnosis of tubular adenocarcinoma of the colon

Although both NGAL and MMP-9 exhibited potential value as independent biomarkers in the detection of tubular adenocarcinoma of the colon,their accuracy wasstill a problem for clinical application.In addition,some of the cases in our study would be misdiagnosed if we measured only one of them.The expression of NGAL in 10 cases did not match the pathological examination results,and the accuracy of NGAL was 75%(Table 2).Similarly,the accuracy of MMP-9 was 72.5%.However,we found that the accuracy was improved to 87.5% when NGAL and MMP-9 were combined for the diagnosis of tubular adenocarcinoma of the colon.Only one of 40 cases was misdiagnosed(Table 2,Figure 4).Therefore,it is suggested that NGAL and MMP-9 may be used in combination to enhance diagnostic accuracy of tubular adenocarcinoma of the colon.

Figure 2 Expression of neutrophil gelatinase-associated lipocalin and matrix metalloproteinase-9 in tubular adenocarcinoma of the colon.A and B:The relative neutrophil gelatinase-associated lipocalin(NGAL)(A)and matrix metalloproteinase-9(MMP-9)(B)gene expression in serum samples from normal tissues(n= 10)and patient tissues with different stages of tubular adenocarcinoma of the colon(From I to III)(n = 30);C and D:Western blotting analysis of the expression of NGAL(C)and MMP-9(D)at the protein level.Three independent experiments were carried and analyzed.Data are expressed as mean values ± SE,bP<0.01,two-tailed Student’s t-tests.NGAL:Neutrophil gelatinase-associated lipocalin;MMP-9:Matrix metalloproteinase-9.

Figure 3 Neutrophil gelatinase-associated lipocalin and matrix metalloproteinase-9 immunoexpression in tubular adenocarcinoma of the colon(original magnification,200 ×).Upper panel:Neutrophil gelatinase-associated lipocalin staining;Lower panel:Matrix metalloproteinase-9 staining.A and E:Control;B and F:Polyps;C and G:Mild tubular adenocarcinoma;D and H:Severe tubular adenocarcinoma.

Figure 4 The combination of neutrophil gelatinase-associated lipocalin and matrix metalloproteinase-9 improved the accuracy of the diagnosis of tubular adenocarcinoma of the colon.Data are expressed as mean values ± SE,bP<0.01,two-tailed Student’s t-tests.NGAL:Neutrophil gelatinase-associated lipocalin;pro-GRP:Pro-gastrin-releasing peptide;MMP-9:Matrix metalloproteinase-9.

Table 2 Serum levels of pro-gastrin-releasing peptide,neutrophil gelatinase-associated lipocalin/matrix metalloproteinase-9 in different patient groups

M:Male;F:Female;NGAL:Neutrophil gelatinase-associated lipocalin pro-GRP:Pro-gastrin-releasing peptide;MMP-9:Matrix metalloproteinase-9.

The diagnostic value of the combination of NGAL and MMP-9 in clinical application

As pro-GRP is a commonly used tumor diagnostic marker,we measured the content of pro-GRP in these 40 cases,and 77.5% of the measured pro-GRP values correctly indicated the progression of tubular adenocarcinoma of the colon(Figure 5 and Table 2).By comparing the diagnostic results of the combination of NGAL and MMP-9,we found that most of results were consistent,indicating that the combination of NGAL and MMP-9 is reliable in clinical application.Moreover,although using pro-GRP was more accurate than using NGAL or MMP-9 alone,there was still a 22.5% probability of error,which was diagnosed correctly when using NGAL and MMP-9 together.

Figure 5 Content of pro-gastrin-releasing peptide(pg/mL)in serum samples from normal tissues(n = 10)and from patient tissues with different stages of tubular adenocarcinoma of the colon(stage I-III)(n = 10).Three independent experiments were carried out and analyzed.Data are expressed as mean values ± SE,bP<0.01,two-tailed Student’s t-tests.pro-GRP:Pro-gastrin-releasing peptide.

DISCUSSION

Despite significant medical progress in recent years,cancer is still one of the most common causes of death.Early-stage tubular adenocarcinoma of the colon is usually cured by surgical excision,but it is difficult to detect this disease in the early stage[10,11],which is due to the lack of effective biomarkers.More importantly,it is necessary to determine the progression of tubular adenocarcinoma of the colon during treatment,to allow efficient evaluation and adjustment of therapeutic strategies.

NGAL and MMP-9 have been reported to be involved in several types of cancers and have been used as biomarkers to indicate disease progression[10-15].In our study,we found that the expression of NGAL was positively related to the occurrence of tubular adenocarcinoma of the colon using qRT-PCR.The expression of NGAL was closely related to the development of tubular adenocarcinoma of the colon,suggesting that NGAL could be used to indicate progression.The results for NGAL were consistent with those for pro-GRP,suggesting that NGAL is reliable for indicating disease progression.On the other hand,we also demonstrated that MMP-9 could be considered another potential biomarker for tubular adenocarcinoma of the colon.Our results showed that although the expression of MMP-9 in patients with stage I disease was only slightly higher than that in the control,it was lower than the expression of NGAL in stage I disease,which was consistent with the conclusion of a previous study which showed that the expression of MMP-9 was induced by NGAL[22].The expression of MMP-9 continued to increase as tubular adenocarcinoma of the colon progressed,suggesting that MMP-9 is also suitable for indicating disease progression.We also detected protein expression and analyzed pathological tissue using Western blotting and IHC staining,respectively,and the findings were consistent with the results shown above and demonstrated the potential value of NGAL and MMP-9 as biomarkers for clinical application.

Most importantly,we found that the combination of NGAL and MMP-9 in the diagnosis of 40 clinical cases significantly improved diagnostic accuracy up to 87.5%,which was higher than that achieved using NGAL,MMP-9 or the traditional biomarker pro-GPR alone.This result suggested that combining NGAL and MMP-9 has great potential for detecting tubular adenocarcinoma of the colon.Only one case could not be identified by NGAL and MMP-9.The mechanism of tumorigenesis in this case may have been abnormal and complex,which requires further study.

CONCLUSION

In summary,our study demonstrated that both NGAL and MMP-9 could be used to detect tubular adenocarcinoma of the colon and that the combination of NGAL and MMP-9 showed greater diagnostic accuracy than either biomarker alone.As abnormal expression of NGAL/MMP-9 has been observed in several cancers,such as breast cancer,bladder cancer and gastric cancer,these two biomarkers described here for tubular adenocarcinoma of the colon may also be useful in other cancers.

ARTICLE HIGHLIGHTS

Research background

Tubular adenocarcinoma of the colon,which originates from the epithelium of glands,is a major health concern worldwide.However,it is difficult to detect at an early stage.The lack of biomarkers is a main barrier in the diagnosis and treatment of tubular adenocarcinoma.Neutrophil gelatinase-associated lipocalin(NGAL)is a secreted protein,which induces the expression of matrix metalloproteinase-9(MMP-9)and is involved in various tumors.NGAL and MMP-9 have been reported to be associated with tumorigenesis and tumor development.They may be potential biomarkers for the diagnosis of tubular adenocarcinoma of the colon.

Research motivation

The combination of NGAL and MMP9 are promising biomarkers for the early detection of tubular adenocarcinoma of the colon.To evaluate whether NGAL and MMP-9 can be used as potential biomarkers to indicate the progression of tubular adenocarcinoma of the colon,it may be beneficial to detect this tumor at the molecular level in the very early stage.

Research objectives

We evaluated whether NGAL and MMP-9 can be used as potential biomarkers to indicate the progression of tubular adenocarcinoma of the colon as patients with this disease will require early diagnosis and treatment.

Research methods

Samples were collected from the colonic mucosa of various patients.Ten patients had polyps(I),10 patients had mild tubular adenocarcinoma(II)and 10 patients had severe tubular adenocarcinoma(III),respectively,confirmed by a pathologist.In addition,10 normal samples were included as controls.The content of pro-gastrin-releasing peptide(pro-GRP)in serum was measured by an electrochemiluminescence immunoassay.The mRNA expression of NGAL and MMP-9 was examined by quantitative real-time PCR(qRT-PCR)analysis,and their protein expression was examined by Western blotting and immunohistochemical(IHC)analysis.According to the status of tubular adenocarcinoma of the colon,the patients were divided into three groups.Thus,the clinical grouping in this research was novel,which has not adopted in other studies.

Research results

In this study,we found that NGAL and MMP-9 can be used as biomarkers for detecting tubular adenocarcinoma of the colon and their combination resulted in better diagnostic accuracy.By analyzing the expression of NGAL in tubular adenocarcinoma at different levels,we found that NGAL was significantly up-regulated in primary tubular adenocarcinoma compared with normal tissues.The up-regulation of NGAL was strongly correlated with both the degree of differentiation and the disease stage(I–III),indicating that NGAL could serve as a diagnostic biomarker for tubular adenocarcinoma.Using NGAL as a biomarker for diagnosis,the accuracy was similar to the widely used biomarker pro-GRP,suggesting that NGAL is a reliable biomarker.In addition,the expression of MMP-9 was also strongly correlated with differentiation and stage,demonstrating that MMP-9 can be used as a biomarker to indicate the progression of tubular adenocarcinoma of the colon.More importantly,the combination of NGAL and MMP-9 achieved greater diagnostic accuracy in tubular adenocarcinoma,and these results were further confirmed by immunohistochemical analysis of tissue sections.

Research conclusions

In this study,the up-regulation of NGAL and MMP-9 was strongly correlated with both the degree of differentiation and stage of tubular adenocarcinoma of the colon.Both NGAL and MMP-9 can be used as biomarkers for detecting tubular adenocarcinoma of the colon and their combination achieved better diagnostic accuracy.Patients who develop tubular adenocarcinoma of colon will require early diagnosis and early treatment.

Research perspectives

It is necessary to study more cases of tubular adenocarcinoma of the colon as other factors may be involved in the progression of this disease.A larger scale clinical study may be the best method for future research on this tumor.