Meng Lv, Xiao-Di Ji, Ke-Ke Liu, Ding Yang, Li-Xia Lou, Bo Nie, Jiu-Li Zhao, Ai-Ming Wu
Dongzhimen Hospital, Ministry of Education and Beijing Key Laboratory of Traditional Chinese Medicine Internal Medicine, Beijing University of Chinese Medicine, Beijing 100700, China
ABSTRACT Objective: To explore the cardioprotective mechanism of Wenxin Granules regulating the expression of apoptosis-related genes in cardiomyocytes. Methods: A rat model of myocardial infarction was established and randomly divided into model group, Wenxin granule low-dose group, Wenxin granule high-dose group, metoprolol group and sham operation group. the left ventricular end systole anterior wall thickness(LVAWs), end systole inner diameter (LVIDs),end systole posterior wall thickness (LVPWs), end-diastolic anterior wall thickness (LVAWd),end-diastolic inner diameter (LVIDd), end-diastolic posterior wall thickness(LVPWd)and left ventricular ejection fraction (LVEF) were detected by echocardiography in each group after 2 weeks of treatment. Hematoxylin eosin (HE) staining was used to observe the changes in the cardiac structure of rats in each group. Real-time PCR (Real-time PCR) was used to detect the relative expression of mammalian B-cell lymphoma-2 (BCL-2), BCL-2 related X protein(BAX), Caspase-9 (Caspase-9), and Caspase-3 (Caspase-3) mRNA. TUNEL staining was used to detect changes in the apoptotic rate of rat cardiomyocytes in each group. Results:Compared with the sham operation group, the LVAWs, LVPWs, LVPWd and LVEF of the model group were significantly reduced (P<0.05, P<0.01), and LVIDs and LVIDd were significantly increased (P<0.05, P<0.01). Severe pathological ischemia injury of heart tissue.The relative expression of BCL-2 mRNA and the ratio of BCL-2/BAX in the model group were significantly reduced (P<0.01), while the relative expression of BAX, Caspase-9 and Caspase-3 mRNA was significantly increased (P<0.01). The apoptosis rate was significantly increased (P<0.01). In the low-dose and high-dose groups of Wenxin Granules and the Metoprolol group, LVAWs, LVPWs, LVPW d, and LVEF of rats in each administration group increased significantly (P<0.05, P<0.01), LVIDs , LVIDd was significantly reduced (P<0.05,P<0.01), the pathological damage of the heart tissue was improved, the expression of BCL-2 mRNA and the ratio of BCL-2/BAX were significantly increased (P<0.05, P<0.01), BAX, The expression of Caspase-9 and Caspase-3 mRNA was significantly reduced (P<0.05, P<0.01),and the apoptotic rate of myocardial cells was significantly reduced (P<0.01). Conclusion:Wenxin granule can play a cardioprotective role by regulating the gene expression of BCL-2/BAX/Caspase apoptosis pathway.
Keywords:Wenxin granule BCL-2/BAX/Caspase apoptosis pathway Miocardial infarction?Corresponding author: WU Ai-ming, Ph.D., Associate Researcher.E-mail: wam688@163.com.
Cardiovascular disease ranks first in the total deaths of urban and rural residents in China[1], and the incidence continues to increase,of which the number of patients with coronary heart disease has reached 11 million[2]. Myocardial infarction is an acute and critical condition of coronary heart disease. Due to the blockage of blood supply to the myocardium by the coronary arteries, partial myocardial necrosis occurs due to severe and persistent ischemia.As the necrotic area expands, heart function decreases, and a large number of myocardial cells die, and then died of severe heart failure or concurrent arrhythmia. Studies have shown that regulating myocardial cell apoptosis has positive significance for the treatment of myocardial infarction [3, 4].
Apoptosis is the process of active cell death, which plays a role in removing damaged or redundant cells in the body to maintain the stability of tissues, organs and internal environment. Abnormal apoptosis can also lead to the occurrence of diseases [5]. There are mainly three apoptosis pathways in the body: exogenous,endogenous, and endoplasmic reticulum stress. The endogenous pathway, as the main apoptotic pathway, plays a key role in the pathological progression of myocardial infarction [6, 7], BCL-2 family and Caspase family genes are involved in the regulation of endogenous apoptosis pathways. Studies have found that in ischemia-reperfusion cardiomyocytes, the expression of BCL-2 and BAX genes in the BCL-2 family changes and activates the Caspase apoptosis pathway Start factor Caspase-9 and executive factor Caspase-3, and finally induce cell apoptosis [8-10]. The previous research of the research group found that Wenxin Granules have cardioprotective effects such as improving myocardial cell fibrosis and ventricular remodeling in rats with myocardial infarction [11, 12].However, the underlying mechanism is not clear. This study aims to study the molecular mechanism of Wenxin Granules efficacy from the perspective of gene regulation of the BCL-2/BAX/Caspase apoptotic pathway, and provide new laboratory evidence for promoting its clinical application.
2.1.1 Animals
40 SPF male SD rats, weighing 210±20g, purchased by Beijing Weitong Lihua Experimental Technology corporation, license number SCXK (Beijing)2016-0006. This animal experiment was approved by the Experimental Animal Committee of Dongzhimen Hospital, Beijing University of Chinese Medicine.
2.1.2 Drugs and reagents
Wenxinkeli, Specification 5g/bag (Shandong Buchang Pharmaceutical corporation , National Medicine Standard Z10950026), Metoprolol tartrate tablets, specification 25mg/tablet(AstraZeneca Pharmaceutical corporation. National Medicine Standard H32025391), TUNEL kit (Promega corporation ,Item number G3250), hematoxylin-eosin (HE) stain (Nanjing Jiancheng Technology corporation, item number: D026-1), Trizol kit (Thermo Fisher Scientific, item number: 15596026), Real-time PCR amplification kit ( American ABI company, article number:4472897).
2.1.3 Instrument
Ultra-high resolution small animal ultrasound imaging system(VisualSonics, Canada, model: Vevo 2100), small animal ventilator(ALC-VBS), optical microscope (German Leica Microsystems,model DMC5400), Leica fully automatic closed tissue dehydration machine (Model: ASP300S), Leica tissue embedding machine(model: EG1150H), Leica baking sheet machine (model: HI1220),real-time fluorescent quantitative PCR instrument (model: Stratagene Mx3000P), 4℃ low temperature high-speed centrifuge (American Thermo Company, Thermo).
2.2.1 Model preparation
According to reference [13], the establishment of a rat model of myocardial infarction by ligation of the left anterior descending coronary artery of the heart. Anesthetize the rat with 1% sodium pentobarbital, then prepare the skin on the left front chest area, fix it on the rat board in the supine position, connect the small animal ventilator after tracheal intubation, set the respiratory rate to 80 beats/min, and tidal volume 0.7-0.8 ml. After disinfection of the skin in the operation area, use ophthalmological scissors to cut the skin and muscle layer layer by layer between the three and four ribs in the left anterior chest area. The ophthalmic forceps bluntly separate the rib layer, and after tearing the pericardial capsule, fully expose the scope of operation, under the left atrial appendage A ligation was performed about 2 mm below the bifurcation of the coronary artery, and the myocardial tissue under the ligation line was visible with ischemia and whitening, and then the heart and ribs were reset,and the ribs, muscle layers and skin were sutured layer by layer. The ECG showed ST-segment elevation immediately after the operation,and the formation of pathological Q waves was seen in the ECG 24 hours after the operation.
2.2.2 Groups and Administration
After 24 hours of ECG, the pathological Q wave in leads V3-V6,I, AVL and V1 or V2 was seen as the model qualified and included into the grouping criteria [14]. They were randomly divided into model group, metoprolol group, low-dose and high-dose Wenxin granule groups, and a sham operation group with only threading and no ligation as a control group, with 8 rats in each group. The dose of rats in each group was converted by the equivalent dose conversion method. The low-dose Wenxin granule group (1.35g/kg) and the metoprolol group (2.25×10-3g/kg) used the equivalent dose to stabilize the heart. The dosage (2.7g/kg) of the high-dose granule group was twice that of the low-dose group. Gavage was administered 24 hours after the operation, once a day, for 2 weeks of continuous treatment. The sham operation group and the model group were given equal volume of deionized water.
2.2.3 Echocardiography testing
After 2 weeks of treatment, echocardiography was used to detect the cardiac structure and function of rats in each group. 1% sodium pentobarbital anesthetized by intraperitoneal injection, a wide range of skin preparation in the precordial area, fixed the rat on the operating table, select the parasternal left ventricular short-axis view,detected by two-dimensional ultrasound guided M-curve, the main indicators include Rat left ventricular anterior end-systolic wall thickness (LVAWs), end-systolic diameter (LVIDs), end-systolic posterior wall thickness (LVPWs), end-diastolic anterior wall thickness (LVAWd), end-diastolic diameter (LVIDd), end-diastolic posterior wall thickness (LVPWd) and left ventricular ejection fraction (LVEF). All measured values are the average of three consecutive cardiac cycles.
2.2.4 HE staining
After echocardiography, the heart tissue is taken. After the rat is anesthetized, it is fixed on the rat plate, and the heart is quickly taken out after the chest is opened. The left atrial appendage, right atrium, and right ventricle are cut off with ophthalmic scissors.A tissue block with a thickness of 4mm was cut from the crosssection, soaked in 4% paraformaldehyde solution and fully fixed.The tissue was processed using a fully enclosed tissue dehydrator,and then paraffin embedding and sectioning were carried out. The slice thickness was 4μm. For HE staining, paraffin slices were baked at 60°C for 1 hour, then fully dewaxed with xylene, descended with gradient ethanol, rinsed with tap water for 5 minutes, stained with hematoxylin staining solution for 8 minutes, rinsed with tap water for 5 minutes, hydrochloric acid and alcohol for 40 seconds, tap water Rinse back to blue for 10 minutes, stain the cytoplasm with eosin solution for 8 minutes, rinse with tap water for 3 minutes,dehydration with gradient ethanol, transparent in xylene, mount with neutral gum, and observe the pathological changes of myocardial tissue under an optical microscope.
2.2.5 Real-time PCR detection
The myocardial tissue of the marginal zone of infarcted rats was taken, and the total RNA of the heart was extracted by the Trizol method. Measure OD260/OD280 by UV spectrophotometer,calculate the total RNA concentration of each group, and configure the reverse transcription reaction system according to the kit instructions. Real-time PCR was used to detect the relative expression of the target gene. The amplification conditions were: 95°C pre-denaturation for 10 minutes, 95°C denaturation for 30 seconds, 55°C annealing for 30 seconds, 72°C extension for 20 seconds, and 40 cycles. The primer sequence is: BAX (upstream primer TTGCTACAGGGTTTCATCC,downstream primer GTCCAGTTCATCGCCAAT), BCL-2(upstream primer CAGAATCAAGTGTTCGTCAT, downstream primer TCGTTCTTCACCTCCACCATGA), Caspase-9(upstream primer GCCACTGCCTCATCATCATCCA,downstream primer AGTCTTCATCTCCAGTATCC), Caspase3(upstream primer GAATCCACGAGCAGAGTC ,downstream primer TCAACAAGCCAACCAAGT), HMBS (upstream primer CCTATGTCTGGCTGTCAAG, downstream primer CAACAACTCTGGTTCAATCTC), using HMBS as an internal reference [15] used the 2-ΔΔct method to calculate the relative expression of each target gene.
2.2.6 TUNEL stain
According to the instructions of the TUNEL kit, put the paraffin slices on a baking sheet machine at 60°C for 1 hour, xylene Ⅰ, Ⅱ,and Ⅲ for 15 minutes each, and gradient ethanol for 5 minutes each. After being fully dewaxed and hydrated, place it in the fixing solution. Fix for 15 minutes. After rinsing in PBS, add 20ug/ml proteinase K solution and incubate for 10 minutes at room temperature. After rinsing in PBS, incubate in equilibrium solution for 10 minutes, then add dropwise rTdT incubation buffer and incubate at 37°C for 1 hour. After the incubation is over, stop The solution was stopped for 15 minutes, and then rinsed with PBS, and anti-fluorescence quenching mounting tablets were added dropwise to mount the slides. Image acquisition was performed under a fluorescence microscope, the green fluorescence of apoptotic cell nuclei was observed under 520nm excitation light, and the blue fluorescence of normal cells and normal cells were observed under 460nm excitation light. ImageJ was used to count the number of apoptotic cell nuclei and normal cell nuclei, and calculate the apoptosis rate of each group.
2.2.7 Statistical analysis
Use SPSS software for statistical analysis. Measurement data are expressed as mean±standard deviation(±s ), Data conforming to normal distribution are analyzed by one-way analysis of variance.When the variance is homogeneous, the comparison between groups is performed by the LSD method, and the variance is uneven.The Dunnett's T3 method was used for the comparison between groups, and the non-normally distributed data were tested by the non-parametric rank sum test, and the differences were statistically significant with P<0.05.
Two weeks after myocardial infarction, LVAWs, LVPWs, LVPWd and LVEF in the model group were significantly reduced(P<0.05,P<0.01), and LVIDs and LVIDd were significantly increased(P<0.05,P<0.01); compared with the model group , LVAWs, LVPWs,LVPWd and LVEF of rats in the low and high dose groups of Wenxin Granules and Metoprolol group increased significantly(P<0.05,P<0.01), Wenxin Granules The LVIDd of the low-dose group and the metoprolol group was significantly reduced(P<0.05,P<0.01); the difference in LVAWd was not statistically significant (P>0.05). See Table 1.
Table 1 Comparison of echocardiographic results of rats in each group(±s)

Table 1 Comparison of echocardiographic results of rats in each group(±s)
Note: Compared with the sham operation group,*P<0.05,**P<0.01;Compared with the model group, #P<0.05,##P<0.01.
Group Animals LVAWs(mm) LVIDs(mm) LVPWs(mm) LVAWd(mm) LVIDd(mm) LVPWd(mm) LVEF(%)Sham 8 3.52±0.15 3.31±0.34 3.42±0.18 2.07±0.12 6.56±0.3 2.51±0.21 84.36±0.84 Model 8 1.82±0.11** 6.83±0.5** 2.21±0.2** 1.6±0.16 7.85±0.46* 1.84±0.13* 29.81±4.08**WXKL-LD 8 2.81±0.15*# 4.67±0.38*## 3.28±0.22## 1.86±0.12 6.63±0.34# 2.48±0.12# 54.19±6.02*#WXKL-HD 8 2.7±0.21*# 4.27±0.36## 3.46±0.19## 1.64±0.15 7.11±0.32 2.37±0.09# 63.39±5.52##Metoprolol 8 2.95±0.3## 3.68±0.46## 3.5±0.19## 1.95±0.16 6.06±0.41## 2.7±0.26## 67.15±6.2##
The results of HE staining showed that in the sham operation group,the myocardial fibers were neatly arranged in long strips, the nucleus size and morphology were normal, the cytoplasmic staining was uniform, and the myocardial cell structure was intact; The staining depth is different, and the cell structure is arranged disorderly.Compared with the model group, the myocardial cell structure of each administration group was improved, and the pathological changes were alleviated. see figure 1.

Figure 1 Pathological changes of heart tissue of rats in each group (HE staining 40 ×)
Two weeks after the establishment of myocardial infarction model,compared with the sham operation group, the relative expression of BCL-2 mRNA and the ratio of BCL-2/BAX in the model group were significantly reduced(P<0.01), BAX, Caspase-9, Caspase-3 mRNA expression was significantly increased(P<0.01); after 2 weeks of drug treatment, compared with the model group, the BCL-2/BAX ratio of the Wenxin granule low-dose group was significantly increased(P<0.05), and the BAX mRNA expression was significantly reduced(P<0.05),BCL-2 mRNA expression and BCL-2/BAX ratio increased significantly in the Wenxin Granule high-dose group and Metoprolol group(P<0.05,P<0.01),BAX,Caspase-9, Caspase -3 mRNA expression was significantly reduced(P<0.05,P<0.01).See Table 2.
Two weeks after the establishment of myocardial infarction model,compared with the sham operation group, the apoptosis rate of myocardial cells in the model group was significantly higher(P<0.01); Compared with the model group, the apoptosis rate of cardiomyocytes in the low-dose and high-dose groups of Wenxin granule and metoprolol group was significantly reduced(P<0.01).See Figure 2, Table 3.
Table 2 Comparison of apoptosis related gene expression of rats in each group( ±s )

Table 2 Comparison of apoptosis related gene expression of rats in each group( ±s )
Note: Compared with the sham operation group,*P<0.05,**P<0.01;Compared with the model group, #P<0.05,##P<0.01.
Group Animals BCL-2 BAX BCL-2/BAX Caspase-9 Caspase-3 Sham 8 1.02±0.07 1.03±0.09 1.08±0.18 1.05±0.12 1.01±0.05 Model 8 0.6±0.06** 1.62±0.05** 0.38±0.05** 1.61±0.07** 2.35±0.11**WXKL-LD 8 0.82±0.07 1.37±0.06**# 0.64±0.06*# 1.4±0.1* 1.86±0.15**WXKL-HD 8 0.94±0.04## 1.27±0.07*## 0.76±0.07## 1.3±0.11# 1.43±0.09*##Metoprolol 8 0.85±0.1# 1.25±0.07*## 0.69±0.1*# 1.19±0.1## 1.53±0.18#

Figure 2 Comparison of cardiomyocyte apoptosis rate of rats in each group( Immunofluorescence 40 × )
Table 3 Comparison of apoptosis rate of rats in each group( ±s )

Table 3 Comparison of apoptosis rate of rats in each group( ±s )
Note: Compared with the sham operation group,*P<0.01;Compared with the model group,#P<0.01.
Group Animals Apoptosis Index(%)Sham 8 1.01±0.04 Model 8 5.73±0.33*WXKL-LD 8 2.74±0.12*#WXKL-HD 8 1.46±0.04*#Metoprolol 8 1.43±0.04*#
Myocardial infarction belongs to the category of chest numbness and heartache in Chinese medicine. The pathogenesis is mainly based on deficiency and excess. Among them, Qi deficiency and blood stasis are more common. TCM treatments usually use the method of replenishing qi and activating blood[16].Wenxin Granules are composed of five medicines of Codonopsis, Panax Notoginseng, Amber, Polygonatum, Gansong. It has the effects of replenishing qi, nourishing yin, activating blood, rejuvenating the pulse and relieving palpitations. Studies have shown that Wenxin Granules can effectively reduce the occurrence of arrhythmia after myocardial infarction. Cardioprotective effect [17]. This study found that after ligation of the left anterior descending coronary artery in rats, myocardial blood supply was blocked, resulting in myocardial ischemic necrosis damage, ventricular structure and dysfunction, and left ventricular wall thickness became thinner and left ventricular diameter increased. The left ventricular ejection fraction is reduced,and the physiology and morphology of the heart disease are disordered. The detection results of the above myocardial infarction rat model are highly consistent with the cardiology characteristics of the clinical myocardial infarction patients reported by Liu et al [18] ,Based on this animal model, the pharmacological study of Wenxin Granules has a strong reference value. Compared with the model group, the heart structure function and pathological damage of rats in the Wenxin granule group were significantly improved. The results of this study showed that two weeks after myocardial infarction, the apoptosis index of myocardial cells in the model group increased significantly, indicating that myocardial cell apoptosis in an ischemic and hypoxic state after myocardial infarction increased. Play an important role in the change process [19], The apoptosis level of cardiomyocytes is related to the expression of anti-apoptosis and pro-apoptotic factors. This study further observes the changes in the expression of BCL-2/BAX/Caspase apoptosis pathway genes in myocardial infarction rats and the cardioprotective mechanism of Wenxin Granules .
The results of the study showed that after 2 weeks of myocardial infarction, the expression of BCL-2 mRNA and the ratio of BCL-2/BAX in the model group were down-regulated, the expression of BAX, Caspase-9, and Caspase-3 mRNA were up-regulated, and the apoptosis index of cardiomyocytes increased significantly, indicating BCL-2/BAX/Caspase is an important way to induce cardiomyocyte apoptosis. After myocardial infarction, apoptotic signals (ischemia,oxidative stress, etc.) are generated in cardiomyocytes, pro-apoptotic gene BAX and anti-apoptotic gene BCL- 2 By regulating the permeability of the outer mitochondrial membrane and regulating the mitochondrial apoptosis pathway, the cytochrome C and apoptosis-inducing factor (AIF) in the mitochondria can be released into the cytoplasm, and Caspase-9 can be activated to participate in the initiation of apoptosis. Activates Caspase-3, the executor of downstream apoptosis, affects DNA replication, degrades apoptosis inhibitor proteins, etc., and promotes cardiomyocyte apoptosis[20-23], It is manifested as an increase in the apoptotic rate of myocardial cells and aggravation of the rational damage of heart disease.This is the molecular mechanism leading to the rational change of heart disease in the model group. This result is consistent with the apoptosis study of Chen et al. in rats with myocardial infarction [24].BCL-2 can inhibit the activity of BAX to prevent it from embedding on the outer mitochondrial membrane, thereby inhibiting the activity of the Caspase family and exerting an anti-apoptotic effect. The results of this study confirm that Wenxin Granules can regulate the above process at the gene level to inhibit the excessive apoptosis of cardiomyocytes.
In summary, Wenxin Granules can reduce apoptosis mediated by the BCL-2/BAX/Caspase apoptosis pathway by up-regulating the expression of the apoptosis inhibitor BCL-2 gene. This is the molecule that Wenxin Granules play a cardioprotective effect. One of the mechanisms. See Figure 3.

Figure 3 Wenxinkeli regulates gene expression of BCL-2/BAX/Caspase apoptosis pathway in rats with myocardial infarction
This study is only limited to the overall animal level to investigate the regulation of BCL-2/BAX/Caspase apoptosis pathway gene expression in the heart of rats with myocardial infarction by Wenxin Granules. Follow-up studies will further conduct experimental verification at the cell level and protein expression.
Author Conflict of Interest Statement
All authors declare that there is no conflict of interest.
Author contribution
Corresponding author Wu Aiming designed the experiment,modeled the experiment and reviewed the article. Nie Bo and Lou Lixia provided technical guidance for the experiment. Zhao Jiuli provided technical support for echocardiographic index detection. Lv Meng, Ji Xiaodi, Liu Keke, and Zhao Jiuli were responsible for drug intervention and index testing. Data analysis, the first author wrote the paper.
Journal of Hainan Medical College2022年7期