Effect of moxibustion on N-methyl-D-aspartate receptor subtype 2B expression in hippocampus of rheumatoid arthritis model rats

PENG Chuanyu (彭傳玉), HU Ling (胡玲), WU Zijian (吳子建), CAI Ronglin (蔡榮林), JIANG Zhiming (蔣志明)

1 College of Acupuncture and Moxibustion, Anhui University of Chinese Medicine, Hefei 230038, China

2 Institute of Acupuncture and Meridian, Anhui Academy of Chinese Medicine, Hefei 230038, china

Abstract

Keywords: Moxibustion Therapy; Moxa Stick Moxibustion; Arthritis, Rheumatoid; Analgesia; Point, Shenshu (BL23); Point,Zusanli (ST36); Rats

Rheumatoid arthritis (RA) is an autoimmune disease characterized by joint pain, swelling, deformity, and functional limitations. The exact pathogenesis of RA has not yet been elucidated. Pain often indicates the active,acute, or developing phase of RA. Analgesic therapy is of great significance to relieve pain and improve the patient’s quality of life[1].

N-methyl-D-aspartic acid (NMDA) is an ionotropic glutamate receptor that plays an important role in the generation and maintenance of inflammatory pain. Rat hippocampal NMDA receptors are involved in the formation of central hyperalgesia[2-3], and the NMDA receptor subtype 2B (NR2B) is the main subunit involved in pain modulation. Studies have shown that moxibustion has a good analgesic effect on RA[4-5]. In this study, we investigated the effect of moxibustion on the expression of NR2B and its phosphorylated level in RA model rats, to explore the analgesic mechanism of moxibustion in RA treatment.

1 Materials and Methods

1.1 Experimental animals and groups

Sixty healthy male Sprague-Dawley rats with body mass of (200±20) g were provided by the Anhui Experimental Animal Center [License No. SCXK (Wan)2017-001]. The laboratory temperature was (27±0.5) ℃,and the humidity was (60±5)%. Rats had free access to food and water. After one week of adaptive feeding, the rats were randomly divided into a normal group, a model group, a moxibustion group, a moxibustion +NMDA receptor antagonist (AP-5) group (moxibustion +AP-5 group), and a moxibustion + NMDA receptor agonist group (moxibustion + NMDA group), with 12 rats in each group. The experiments strictly complied with the relevant regulations in theGuiding Principles for the Care of Experimental Animalsformulated by the Ministry of Science and Technology of the People’s Republic of China.

1.2 Main instruments and reagents

JW-3021HR desktop high-speed refrigerated centrifuge (Anhui Jiawen Instruments, China); BWPlantar 390 thermal pain meter (IITC Life Science, USA);PIKOREAL96 fluorescence quantitative polymerase chain reaction (qPCR) instrument (Thermo, USA);OD1000+ ultramicrospectrophotometer (Nanjing Wuyi Technology, China).

Chloroform (Lot No. 20161013), absolute ethanol(Lot No. 20200101), isopropanol (Lot No. 20171030),(Shanghai Suyi Chemical Reagent, China); trizol (Lot No.251804, Life Technologies, USA); goat anti-mouse immunoglobulin (Ig) G (Lot No. 140193), goat antirabbit IgG (Lot No. 202700514), (Zhongshan Jinqiao,China); NR2B antibody (Lot No. GR3257880-4, Abcam,UK); ECL hypersensitivity luminescence kit (Lot No.Vc298015, Thermo, USA); PAGE gel preparation kit (Lot No. 1017M021, Beijing Solarbio Science & Technology Co., Ltd., China); phospho-NR2B antibody (Lot No.AG01542026, Bioss, UK).

1.3 Modeling method

In this study, the “combination of disease and syndrome” modeling method, that is, the combined modeling method of windy, cold, and damp environmental factors plus biological factors, was used to replicate the RA model[6].

Rats were placed in a self-made box for modeling with the inside humidity controlled at 80%-90% by an ultrasonic atomizer, and a controlled ambient temperature at (6±2) ℃ by ice, for 20 d (12 h/d,20:00-8:00). On the 21st day of the experiment, except for the rats in the normal group, each rat’s right hind paw was disinfected with 75% alcohol to receive the injection of 0.15 mL complete Freund’s adjuvant to induce inflammation. After 3 d of observation, the successful modeling was confirmed by acute inflammation, ankle swelling, as well as redness,swelling, or inflammatory nodules in the forelimbs, the contralateral limb, or other locations[7].

1.4 Intervention methods for each group

Rats in the normal group and the model group did not receive any intervention, while rats in the other three groups received the same moxibustion treatment.Points: Bilateral Shenshu (BL23) and Zusanli (ST36).

Methods:Marked the points after positioning following theExperimental Acupuncture Science[8].Shenshu (BL23) and Zusanli (ST36) were used alternately, and both sides of the same point were selected at the same time. Starting from the 24th day of modeling, suspended moxibustion was performed with a special cigarette-shaped pure moxa stick for 20 min at a distance of 2 cm from the points.

At 30 min before moxibustion, rats in the moxibustion + AP-5 group and the moxibustion + NMDA group were given intraperitoneal injection of NMDA antagonist AP-5 [0.7 mg/(kg.bw)] or NMDA agonist NMDA [5 mg/(kg.bw)], respectively. Other treatments were the same as in the moxibustion group.

1.5 Observation items and detection methods

1.5.1 Thermal withdrawal latency (TWL)

The TWL was detected using the BW-Plantar 390 thermal pain meter before modeling, on the 23rd day,and the 39th day of the experiment. The rats were placed in a plexiglass container (3 cm in thickness) for adapting to the environment for 20-30 min. The bottom of the right hind paw of the rat was irradiated with a thermal radiation stimulator. The time from the beginning of irradiation to the appearance of foot lifting was taken as the TWL value. Repeated it three times at an interval of 5 min. The average value of 3 times was included after excluding the maximum and the minimum values.

1.5.2 Morphological observation with hematoxylineosin (HE) staining of knee joint

Rats were anesthetized and sacrificed after intraperitoneal injection of 10% chloral hydrate solution[3 mL/(kg.bw)], and then immobilized in a supine position. Knee joints were isolated, placed in 4%paraformaldehyde solution for 24 h, then dehydrated,transparent, paraffin-embedded, sectioned, and stained with HE to observe the pathological changes under a light microscope.

1.5.3 Detection of NR2B mRNA expression in rat hippocampus by real-time qPCR (RT-qPCR) method

Fifty-milligram hippocampal tissue was collected and lysed by adding trizol to extract the total RNAs. RT-qPCR was used to detect the NR2B mRNA expression in the hippocampal tissue with β-actin as the internal reference. The probes used are shown in Table 1.Reaction conditions: 95 ℃ for 1 min, 95 ℃ for 20 s,60 ℃ for 1 min, for a total of 40 cycles. The relative expression of NR2B mRNA was calculated based on 2-??ct.

Name Amplification length (bp) Upstream primer sequence (5'→3') Downstream primer sequence (5'→3')NR2B 133 TACAACACCCACGAGAAGA GGATTATCACCAGCTTCG-3 β-actin 150 CCCATCTATGAGGGTTACGC TTTAATGTCACGCACGATTTC

1.5.4 Western blotting for the protein and phosphorylated protein expression levels of hippocampal NR2B

In 100 mg hippocampal tissue, added 1 mL cell lysate(radio immunoprecipitation assay, RIPA), centrifuged it at 12 000 r/min for 10 min, collected the supernatant,added loading buffer (1:4 in volume), and boiled it for 5 min. After electrophoresis, membrane transfer,blocking, incubating with diluted primary antibody(1:1 000 dilution) at 4 ℃ overnight, incubating with diluted secondary antibody (1: 20 000 dilution) at room temperature for 1.2 h, the membrane was washed with phosphate-buffered saline with Tween-20 (PBST)3 times for 10 min/time. Enhanced chemiluminescence(ECL) kit was used for chemiluminescence, film development, and fixing. The molecular weight and the net absorbance value of the target bands were analyzed using the gel image processing system.

1.6 Statistical methods

Graphpad Prism 6 and SPSS version 22.0 statistical software were used for statistical analysis and imaging,respectively. Measurement data conforming to the normal distribution and the homogeneity of variance were presented as mean ± standard deviation (±s).One-way analysis of variance was used for comparisons between groups, and the least significant difference method was used for pairwise comparisons. For the data with a heterogeneity of variance, a nonparametric test was used.P＜0.05 meant the difference was statistically significant.

2 Results

2.1 Comparison of the rat TWL of the right hind paw among groups

There was no significant difference in the TWL(namely thermal pain threshold) of the right hind paw among the groups before modeling (P＞0.05). After modeling, the TWL value of rats in the model group, the moxibustion group, the moxibustion + AP-5 group, and the moxibustion + NMDA group was lower than that in the normal group (P＜0.01). After 15 d of intervention,the TWL value of rats in the moxibustion group, the moxibustion + AP-5 group, and the moxibustion +NMDA group was higher than that in the model group(P＜0.01 orP＜0.05). At the same time, the TWL value of rats in the moxibustion + AP-5 group was higher than that in the moxibustion group (P＜0.01); the TWL value of rats in the moxibustion + NMDA group was lower than that in the moxibustion group (P＜0.01), (Figure 1).

2.2 HE staining observation of rat knee joint in each group

After the 15-day intervention, the cartilage surface was smooth and flat, the chondrocytes were neatly arranged, and there was no synovial tissue hyperplasia or inflammatory cell infiltration in the normal group.The cartilage surface was not smooth, the chondrocytes were irregularly arranged, and the synovial tissue proliferated significantly, accompanied by severe inflammatory cell infiltration in the model group.Compared with the model group, the synovial tissue of the moxibustion group, the moxibustion + AP-5 group,and the moxibustion + NMDA group only presented with various degrees of hyperplasia and inflammatory cells infiltration, and the knee joint morphology was improved to varying degrees. Compared with the moxibustion group, the improvement in the moxibustion + AP-5 group was more obvious (Figure 2).

Figure 1. Comparison of the thermal withdrawal latency of right hind paw among groups (n=12)

2.3 Comparison of the mRNA expression level of NR2B in rat hippocampus among groups

After the 15-day intervention, the mRNA expression level of NR2B in the hippocampus in the model group was higher than that in the normal group (P＜0.01). The mRNA expression level of hippocampal NR2B in the moxibustion group, the moxibustion+AP-5 group, and the moxibustion + NMDA group was lower than that in the model group (P＜0.01). The rat mRNA expression level of hippocampal NR2B in the moxibustion + AP-5 group was lower than that in the moxibustion group(P＜0.01), and the mRNA expression level of hippocampal NR2B in the moxibustion + NMDA group was higher than that in the moxibustion group (P＜0.01),(Figure 3).

2.4 Comparison of the protein and phosphorylated protein expression levels of hippocampal NR2B of rats among groups

After the 15-day intervention, the protein and phosphorylated protein expression levels of hippocampal NR2B in the model group were higher than those in the normal group (P＜0.01); the protein and phosphorylated protein expression levels of hippocampal NR2B in the moxibustion group, the moxibustion + AP-5 group, and the moxibustion +NMDA group were lower than those in the model group(P＜0.01); the protein and phosphorylated protein expression levels of hippocampal NR2B in rats in the moxibustion + AP-5 group were lower than those in the moxibustion group (P＜0.01); the protein and phosphorylated protein expression levels of hippocampal NR2B in rats in the moxibustion + NMDA group were higher than those in the moxibustion group(P＜0.01), (Figure 4 and Figure 5).

Figure 3. Comparison of the mRNA expression level of NR2B in the rat hippocampus among groups (n=12)

3 Discussion

Traditional Chinese medicine believes that RA belongs to the category of “arthralgia”. It is mainly caused by pathogens such as wind, cold, and dampness,which enter the interior, block the meridians, and lead to stagnant Qi and blood, affecting muscles and joints and resulting in pain, swelling, and even joint dysfunction[9]. So far, there is no specific cure for RA,and the main treatment strategy is to inhibit inflammation progression and improve joint function,so as to achieve the purpose of relieving pain,preventing deformity, and improving quality of life[10].

In this study, the modeling method of “combination of disease and syndrome” was used, which has been confirmed in previous experiments[11]. Rats in the model group developed red swelling or inflammatory nodules in the limbs, and the thermal pain threshold significantly reduced after modeling, indicating that the modeling was successful.

Moxibustion is a therapeutic method with good curative effect and few side effects, showing a good analgesic effect on RA[12-13]. In this study, moxibustion at Shenshu (BL23) and Zusanli (ST36) was adopted, and the protein and phosphorylated protein expression levels of NR2R in rat hippocampus of each group were observed, to explore the analgesic mechanism of moxibustion in RA treatment.

NMDA receptor is a glutamate ionotropic receptor. It not only participates in physiological processes such as neural development, learning, and memory but also plays an important role in pathological processes such as the onset and maintenance of pain[14-15]. Activation of NMDA receptors plays an important role in the generation and maintenance of hyperalgesia. NMDA receptor agonists enhance the formation and development of hyperalgesia, while its antagonists attenuate the hyperalgesia in the inflammatory areas.Studies showed that intraperitoneal injection of NMDA receptor competitive antagonist reduced the hyperalgesia level in rats with selective injury of sciatic nerve branches, while intraperitoneal injection of NMDA receptor agonist contributed to the occurrence and development of local pain hypersensitivity in inflammatory rats, and reduced the antinociceptive responses in distant sites[16-17]. Therefore, in this study,moxibustion combined with NMDA receptor competitive antagonist AP-5 or NMDA receptor agonist NMDA were compared with moxibustion intervention to observe the effectiveness difference among various intervention strategies.

NMDA receptor mainly includes NR1, NR2, and NR3 subunits. NR2B is an important regulatory subunit with limited distribution in the spinal cord, hippocampus,cortex, olfactory bulb and striatum, and other regions of the brain. NR2B is involved in the expansion of peripheral pain perception threshold, the formation of the central hyperexcitability, and the hyperalgesia,playing an important role in pain generation and central hyperalgesia formation[18-20]. In terms of NR2B gene expression, acupuncture can down-regulate the expression of NR2B mRNA in the spinal cord neurons related to central sensitization, thus playing a role in regulating the mechanism of pain information in rats[21].Protein phosphorylation is the main mechanism to regulate the function of NMDA receptors. NR2B is the main site of tyrosine phosphorylation, and NR2B tyrosine phosphorylation promotes the activation of nociceptors in the spinal cord, leading to persistent pain after inflammatory responses[22-23]. XU L S,et al[24]demonstrated that the expression level of phosphorylated NR2B was significantly increased after a sustained inflammatory response.

To date, few studies have focused on the analgesic mechanism of moxibustion based on the NMDA receptor NR2B. Therefore, this study observed the effect of moxibustion on the expression level of NR2B and explored the analgesic mechanism of moxibustion in RA treatment.

The results of this study found that the mRNA,protein, and phosphorylated protein levels of NR2B in the hippocampus of the model group were significantly higher than those in the normal group. The pathomorphology of the knee joint showed that the cartilage surface in the model group was not smooth,the chondrocytes were irregularly arranged, and the synovial tissues abnormally proliferated. After moxibustion intervention, the mRNA, protein, and phosphorylated protein expression levels of NR2B in the hippocampus of RA rats were significantly decreased,and the thermal pain threshold was increased; at the same time, the synovial tissue hyperplasia was reduced,and the inflammatory cell infiltration was improved,indicating that moxibustion attenuates the hyperalgesia in RA rats. The mechanism may be related to the NR2B expression regulated by moxibustion. This result is consistent with the reports that electroacupuncture may play a role in intervening in the formation and maintenance of central sensitization by down-regulating the NR2B expression, showing an analgesic effect[19].

Moreover, this study revealed that the mRNA, protein,and phosphorylated protein levels of NR2B in the rat hippocampus in the moxibustion + AP-5 group were lower than those in the moxibustion group, and were higher in the moxibustion + NMDA group than in the moxibustion group, suggesting that the NMDA receptor antagonist AP-5 can inhibit the pain response induced by inflammatory stimulation, and the NMDA agonist NMDA can enhance it. These findings further indicate that moxibustion may reduce the hyperalgesia due to local inflammation, increase the pain threshold, and play an analgesic role by reducing the mRNA, protein,and phosphorylated protein levels of hippocampal NR2B. Thereby, the local RA symptoms can be further relieved to achieve the purpose of treating RA. However,this study only investigated the expression levels of mRNA, protein, and phosphorylated protein of NR2B modulated by moxibustion. Further research is necessary for exploring the signaling that down-regulates the NR2B expression for increasing the pain threshold.

Conflict of Interest

The authors declare that there is no potential conflict in this article.

Acknowledgments

This work was supported by National Basic Research Program of China (973 Program, 國家重點基礎(chǔ)研究發(fā)展計劃, No. 2015CB554504); Key Project of Natural Science Research in Universities of Anhui Province (安徽高校自然科學(xué)研究重點項目, No. KJ2021A0571).

Statement of Human and Animal Rights

The treatment of animals conformed to the ethical criteria in this experiment.Received: 25 March 2021/Accepted: 18 August 2021